/aliases/cpndb/fasta_results/b12498.fasta# /aliases/cpndb/fasta35 -E 200 -Q -m 6 -b 20 -d 20 -z 2 -H /aliases/cpndb/fasta_results/b12498 /aliases/cpndb/blastDBs/reference_a_nut
FASTA searches a protein or DNA sequence data bank
 version 35.03 Feb. 18, 2008
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

Query: /aliases/cpndb/fasta_results/b12498
  1>>>b12498 555 nt - 555 nt
Library: /aliases/cpndb/blastDBs/reference_a_nut 10049508 residues in 18128 sequences

10049508 residues in 18128 sequences
Statistics: MLE_cen statistics: Lambda= 0.0039;  K=3.549e-05 (cen=906)
Algorithm: FASTA (3.5 Sept 2006) [optimized]
Parameters: +5/-4 matrix (5:-4) ktup: 6
 join: 51, opt: 36, open/ext: -12/-4, width:  16
 Scan time:  1.690



The best scores are:                                      opt bits E(18128)
b11999 NC_011729 Cyanothece sp. PCC 7424       ( 555) [f] 2280 27.6      27 align
b31165 NZ_AP017375  Stanieria sp. NIES-3757    ( 555) [f] 1852 25.2 1.4e+02 align
b11951 NC_011726 Cyanothece sp. PCC 8801       ( 555) [f] 1803 24.9 1.8e+02 align
b13338 AB039630 Stanieria cyanosphaera PCC 743 ( 555) [f] 1789 24.8 1.8e+02 align
b13339 AB039629 Pleurocapsa sp. PCC 7516       ( 555) [f] 1783 24.8 1.9e+02 align
b10742 AP009552 Microcystis aeruginosa NIES-84 ( 555) [f] 1762 24.7   2e+02 align
b20906 CAIN01000088 Microcystis aeruginosa PCC ( 555) [f] 1762 24.7   2e+02 align
b34672 NZ_CP011339 Microcystis  panniformis  F ( 555) [f] 1762 24.7   2e+02 align
b33603 QQWD01000003 Microcystis  wesenbergii T ( 555) [f] 1753 24.6 2.1e+02 align
b33604 QQWB01000017 Microcystis  flos-aquae DF ( 555) [f] 1744 24.6 2.2e+02 align
b31225 NZ_PEBC01000002 Cyanobacterium  aponinu ( 555) [f] 1744 24.6 2.2e+02 align
b32050 PVWM01000747 Chroococcidiopsis cubana C ( 555) [f] 1744 24.6 2.2e+02 align
b32054 PVWL01000071 Cyanosarcina  cf. burmensi ( 555) [f] 1744 24.6 2.2e+02 align
b22606 ANKQ01000002 Microcystis aeruginosa TAI ( 555) [f] 1744 24.6 2.2e+02 align
b31254 PEBC01000002 Cyanobacterium  aponinum   ( 555) [f] 1744 24.6 2.2e+02 align
b29641 NZ_NEED01000002 Cyanobacterium sp. SU2  ( 555) [f] 1744 24.6 2.2e+02 align
b33173 QBMS01000016 Snowella  sp. ULC335bin1   ( 555) [f] 1740 24.6 2.2e+02 align
b13340 AB039628 Pleurocapsa sp. PCC 7327       ( 555) [f] 1740 24.6 2.2e+02 align
b13342 AB039626 Chroococcidiopsis thermalis PC ( 555) [f] 1735 24.5 2.3e+02 align
b34822 BJCE01000279 Sphaerospermopsis  renifor ( 555) [f] 1735 24.5 2.3e+02 align


>>>b12498, 555 nt vs /aliases/cpndb/blastDBs/reference_a_nut library

>>b11999 NC_011729 Cyanothece sp. PCC 7424                (555 nt)
 initn: 2253 init1: 2253 opt: 2280  Z-score: 96.2  bits: 27.6 E():   27
banded Smith-Waterman score: 2280; 90.1% identity (90.1% similar) in 555 nt overlap (1-555:1-555)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: :::::::::::::::::::::::::::::::: :::::::::::::::::: b11999 GCAACCGTCCTCGCTCACGCAATGGTTAAAGAAGGGTTACGTAACGTTGCTGCTGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::::::::::::::: ::::::::::: ::::: : :: :::::::::: :: ::: b11999 AACCCCATTTCTATCAAACGTGGGATCGATAAAGCAATTGAATATTTAGTCGCTAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::: ::::: :: ::::: :: ::::::::::::::::: ::::: :: ::: b11999 GCTGAACACGCCAAACCTGTAGAAGATTCTAAAGCGATCTCTCAAGTCGGTGCAATTTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: :::::::: ::::::::::: : :::::::::: : :::::::::::::::::::: b11999 GCCGGTAACGACGAAGAAGTCGGTAACATGATCGCTGAGGCGATGGATAAAGTCGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::::::::: :: :: ::::::::::: :: ::::: :::::::: ::::: :::::: b11999 GAAGGGGTTATTTCTCTTGAAGAAGGGAAATCAATGACTACCGAACTGGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: ::::::::::::::::::::::: :: :: ::::::::::::::: b11999 GGGATGCGCTTTGACAAGGGTTATATCTCTCCCTACTTTGTCACCGATACAGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA ::::::::::::::::: ::::: ::::::::::::::::::::::: :: :: :: ::: b11999 GAGTGCGTTTTCGATGATCCCGCTATCCTGCTCACCGATAAGAAAATTGCCCTCGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: ::::: :::::::::::::::::::::::::::::::::::::: :::::: b11999 GATTTAGTTCCTGTTTTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATCCTCGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::::::::::::::: :: :::::: :::: :::::::::::::::::::: ::: b11999 GAAGATATCGAAAAAGAAGCTCTCGCTACTTTAGTGGTTAACCGTCTGCGCGGTGTCTTA 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT ::::: ::::::::: b11999 AATGTTGCTGCGGTT 550


>>b31165 NZ_AP017375  Stanieria sp. NIES-3757             (555 nt)
 initn: 1756 init1: 1756 opt: 1852  Z-score: 83.1  bits: 25.2 E(): 1.4e+02
banded Smith-Waterman score: 1852; 81.6% identity (81.6% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT ::::: :: :: :::::::: :: ::::::::::: :::::::::::::::::::::::: b31165 GCTACAGTTCTAGCTCACGCGATTGTTAAAGAAGGTTTACGCAACGTTGCTGCTGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: ::::: :: :::: :: :: :: :: ::::: :: :: :::::::::: ::: ::: b31165 AATCCCATCGCTCTCAAACGAGGAATTGATAAAGCCACTGAATATTTAGTCGACAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::::: : :::::::::::::::::::: : ::::: : ::: :::::: b31165 GCTCAACACGCTAAGCAAATTGAAGACTCCAAAGCGATCGCGCAAGTTGCTGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::::::::: :: :::::::::::: :::::::::::::::: ::::: b31165 GCTGGTAACGATGAAGAAGTAGGTAGCATGATCGCTGAAGCGATGGATAAAGTAGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: ::::::::::: :::::::: ::::::::::: :::::: : :::::::: ::: b31165 GAAGGCGTTATCTCCCTTGAAGAAGGTAAGTCCATGACTACCGAATTAGAAATTACTGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: :: ::::: : :::::: ::::: :: :: ::::: :: :: ::: b31165 GGGATGCGCTTTGACAAAGGTTACACCTCTCCTTACTTTGTCACCGATACCGAACGTATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: ::: : ::::: :: :::: :: :::: ::::: :::::: : :::::::: b31165 GAAGCAGTTCTGGATGATCCTTTCATCTTGATCACTGATAAAAAAATCACTTTAGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: ::::: :: :: :::::::: :: :::::: :::::::: :: : :: ::::: b31165 GACTTAGTTCCAGTTTTAGAACAAGTAGCTCGTCAAGGCAAACCCTTGATGATCATCGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :::::: :::: :: :::::::: :: :: ::: : b31165 GAAGACATCGAAAAAGAAGCTTTAGCTACTTTAGTTGTCAACCGTCTCCGTGGCGTACTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT ::::: :: :: :: b31165 AATGTAGCAGCAGTA 550


>>b11951 NC_011726 Cyanothece sp. PCC 8801                (555 nt)
 initn: 1803 init1: 1803 opt: 1803  Z-score: 81.7  bits: 24.9 E(): 1.8e+02
banded Smith-Waterman score: 1803; 80.5% identity (80.5% similar) in 555 nt overlap (1-555:1-555)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :::::::: :: :: :: :: :: ::::::::::: ::::: ::::: :: :: :: ::: b11951 GCTACCGTTCTGGCCCATGCTATTGTTAAAGAAGGATTACGAAACGTAGCGGCGGGAGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::::::::: :::: :: :: :: :::::::: ::::: : :::::: : :: ::: b11951 AACCCCATTTCCCTCAAACGAGGCATAGACAAAGCCACCGAATTTTTAGTGGAAAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: : :::::::::: ::::::::::::::::::::: :::::::::: ::::::::: b11951 GCTGCTTACGCTAAACCCGTTGAAGACTCCAAAGCGATCGCTCAAGTGGGAGCCATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG ::::: :: ::::: ::::: :: ::::::::: : :: ::::: ::::: :: :: b11951 GCGGGGAATGATGACGAAGTGGGTCAAATGATCGCTAATGCCATGGACAAAGTGGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::::::::: ::::: :::::::: :::::::::::::::::: : :::::::::::: b11951 GAAGGGGTTATTTCCCTTGAAGAAGGTAAGTCCATGACGACCGAATTGGAAATTACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG ::::::::::::::::: :: :: :: ::::::::::: :: :: :: :: :: :: ::: b11951 GGGATGCGCTTTGATAAAGGCTACATTTCTCCCTACTTTGTCACCGACACCGAACGGATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :: :: :: :: :: :: ::::: :: : :::::::::::::: : ::::: ::: b11951 GAATGTGTCTTAGACGATCCTGCCATTCTCTTAACCGATAAGAAAATTACCCTAGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: ::::: :: :: : ::::: ::::: ::: :::::::: ::: : :: : ::: b11951 GACTTAGTACCCGTTCTCGAACAAGTTGCCCGTCAAGGCAAACCTTTAGTTATCATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::::::::::::::: :: ::::: :::: :: ::::::::::: ::::: : b11951 GAAGATATCGAAAAAGAAGCCCTCGCTACCTTAGTGGTGAACCGTCTGCGGGGTGTTCTG 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT : :: ::::::::: b11951 ACCGTTGCTGCGGTT 550


>>b13338 AB039630 Stanieria cyanosphaera PCC 7437         (555 nt)
 initn: 1708 init1: 1708 opt: 1789  Z-score: 81.2  bits: 24.8 E(): 1.8e+02
banded Smith-Waterman score: 1789; 80.3% identity (80.3% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT ::::: :: :::::::: :: :: :: :::::::: ::::::::::::::::: :::::: b13338 GCTACAGTTCTCGCTCATGCGATTGTCAAAGAAGGCTTACGCAACGTTGCTGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: :: :: :: :::: :: :: :: :: ::::: :: :: :::::::::: ::: ::: b13338 AATCCTATCGCTCTCAAACGCGGAATTGATAAAGCTACAGAATATTTAGTCGACAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: :: : ::::::: :::::::::::: ::::::: ::::: :::::: b13338 GCTCAACACGCCAAGCAAATTGAAGATTCCAAAGCGATCGCTCAAGTTGGTGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: :::::::: :: ::::: :: ::::::::::::::::::::::::::::: ::::: b13338 GCTGGTAACGACGACGAAGTAGGTAGCATGATCGCTCAAGCGATGGATAAAGTAGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: :::::::: ::::: ::::: :::::: : ::::: :: ::: b13338 GAAGGCGTGATTTCCCTTGAAGAAGGTAAGTCTATGACTACCGAATTAGAAATCACTGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: :: ::::::: :::::: ::::: :: :::::::: :: :::::: b13338 GGGATGCGCTTTGACAAAGGTTATACCTCTCCTTACTTTGTCACTGATACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: ::: ::::::: :: ::: :: :::: ::::: :::::: : :::::::: b13338 GAAGCGGTTCTCGATGATCCTTTTATCTTGATCACTGATAAAAAAATCACTTTAGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: ::::: :: :::::::: :: :::::: :::::::: :: : ::: : ::: b13338 GACTTAGTTCCCAGTTTAGAACAAGTAGCTCGTCAAGGCAAACCCTTGATGATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :::::: :::: ::::::::::: :: :: ::: : b13338 GAAGACATCGAAAAAGAAGCTTTAGCTACTTTAGTTGTTAACCGTCTTCGTGGCGTACTC 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :: :: :: b13338 AACGTAGCAGCAGTA 550


>>b13339 AB039629 Pleurocapsa sp. PCC 7516                (555 nt)
 initn: 1717 init1: 1717 opt: 1783  Z-score: 81.0  bits: 24.8 E(): 1.9e+02
banded Smith-Waterman score: 1783; 80.4% identity (80.4% similar) in 551 nt overlap (1-551:1-551)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :: ::::: :::::::: :: ::::::::::: ::::::::::::: :: :: :: b13339 GCAACAGTACTAGCTCACGCTATTGTTAAAGAAGGTCTACGCAACGTTGCAGCAGGGGCA 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::::::: : ::::::::::: ::::::::::: : :::: ::: :: ::::: ::: b13339 AACCCCATTGCGATCAAGCGTGGTATCGACAAAGCAATTGAGTTTTTGGTTGGCAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :::::: ::: :::: :: : :::::::::::::::: ::::::: ::: : :: ::: b13339 CAAGAACAGGCTCAACCTGTAGGAGACTCCAAAGCGATCGCTCAAGTAGGTACAATTTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :::::::: :: :::::::: ::: ::::::: :::::::::::::::::::::: :: b13339 GCGGGTAATGACGAAGAAGTTGGCGACATGATCTCTCAAGCGATGGATAAAGTCGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: :: : :::::::: ::::::::::: :::::::: ::::: :: ::: b13339 GAAGGTGTAATTTCTTTAGAAGAAGGTAAGTCCATGACTACCGAACTAGAAATCACTGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG ::::::::: :::: :: :: ::::: ::::: ::::: :: :::::::: :: :: ::: b13339 GGGATGCGCCTTGACAAAGGCTATATTTCTCCTTACTTTGTTACTGATACTGAACGTATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: : ::: :: :: :: ::: : ::::::: :: :::::: :::: ::: b13339 GAAGCTGCTTTAGAAGAGCCATACATTTTAATCACCGACAAAAAAATCAACTTAGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: :: ::: ::::::: :::::::::::::: :: :: :: ::::: : ::: b13339 GATTTAGTACCAGTACTAGAACAAGTTGCTCGTGCTGGTAAGCCTTTGGTAATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::::::::::::::: : :: ::: : :: :: :::::::: ::::::::::: b13339 GAAGATATCGAAAAAGAAGCTTTAGCCACTTTGGTAGTCAACCGTCTACGCGGTGTATTG 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: ::::: b13339 AACGTAGCTGCCATC 550


>>b10742 AP009552 Microcystis aeruginosa NIES-843         (555 nt)
 initn: 1735 init1: 1735 opt: 1762  Z-score: 80.4  bits: 24.7 E(): 2e+02
banded Smith-Waterman score: 1762; 79.8% identity (79.8% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::::::::: :: ::::::::::: ::::::::::: :: :: :::::: b10742 GCCACCGTTCTCGCTCACGCTATCGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :: ::::: ::::: :::: : : ::: : : :: b10742 AACCCGATTTCTCTGAAAAAAGGTATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: ::::: :::::::::::: : ::::::::::: :::::: b10742 GCCAAACACGCGAAACCCGTAGAAGATTCCAAAGCGATCGCACAAGTGGGTGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: :::::::::::::: :: b10742 GCCGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :: ::::: :::::::: ::::: :::::: b10742 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCGATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: :: :::::: b10742 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b10742 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : ::::: ::::: ::: :::::::: :: ::::: :::: b10742 GATTTGGTTCCCATTCTCGAACAAGTTGCCCGTCAAGGCAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :: :: ::::: :::::::::::::::::::: : b10742 GAAGACATCGAAAAAGAAGCTTTGGCAACCCTAGTGGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: ::: ::::::: b10742 AACGTCACTGCGGTG 550


>>b20906 CAIN01000088 Microcystis aeruginosa PCC 9809     (555 nt)
 initn: 1735 init1: 1735 opt: 1762  Z-score: 80.4  bits: 24.7 E(): 2e+02
banded Smith-Waterman score: 1762; 79.8% identity (79.8% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::::::::: :: ::::::::::: ::::::::::: :: :: :::::: b20906 GCCACCGTTCTCGCTCACGCTATCGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :::::::: ::::: :::: : : ::: : : :: b20906 AACCCGATTTCTCTGAAAAAAGGGATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: :::::::::::::::::: : :::::::: :: :::::: b20906 GCCAAACACGCGAAACCCGTAGAAGACTCCAAAGCGATCGCACAAGTGGGCGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: ::::::::::::::::: b20906 GCCGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :: ::::: :::::::: ::::: :::::: b20906 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCGATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: :: :::::: b20906 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b20906 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : ::::: :: :: ::: :: ::::: :: ::::: :::: b20906 GATTTGGTTCCCATTCTCGAACAAGTGGCCCGTCAAGGTAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :: :: :: :: :::::::::::::::::::: : b20906 GAAGACATCGAAAAAGAAGCTTTGGCAACCCTCGTGGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :::::: ::::::: b20906 AATGTCACTGCGGTG 550


>>b34672 NZ_CP011339 Microcystis  panniformis  FACHB-175  (555 nt)
 initn: 1687 init1: 1687 opt: 1762  Z-score: 80.4  bits: 24.7 E(): 2e+02
banded Smith-Waterman score: 1762; 79.8% identity (79.8% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::: ::::: :: ::::::::::: ::::::::::: :: :: :::::: b34672 GCCACCGTTCTCGCCCACGCTATCGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :: ::::: ::::: :::: : : ::: : : :: b34672 AACCCGATTTCTCTGAAAAAAGGTATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: ::::: :::::::::::: : :::::::: :: :::::: b34672 GCCAAACACGCGAAACCCGTAGAAGATTCCAAAGCGATCGCACAAGTGGGCGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: ::::::::::::::::: b34672 GCCGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :::::::: :::::::: ::::: :::::: b34672 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCCATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: ::::::::: b34672 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b34672 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : :::::::: :: ::: :: ::::: :: ::::: :::: b34672 GATTTGGTTCCCATTCTCGAACAGGTGGCCCGTCAAGGTAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :: :: ::::: :::::::::::::::::::: : b34672 GAAGACATCGAAAAAGAAGCTTTGGCAACCCTAGTAGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: ::: ::::::: b34672 AACGTCACTGCGGTG 550


>>b33603 QQWD01000003 Microcystis  wesenbergii TW10       (555 nt)
 initn: 1678 init1: 1678 opt: 1753  Z-score: 80.1  bits: 24.6 E(): 2.1e+02
banded Smith-Waterman score: 1753; 79.6% identity (79.6% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::: ::::: :: ::::::::::: ::::::::::: :: :: :::::: b33603 GCCACCGTTCTCGCCCACGCTATCGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :: ::::: ::::: :::: : : ::: : : :: b33603 AACCCGATTTCTCTGAAAAAAGGTATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: :::::::::::::::::: : :::::::: :: :::::: b33603 GCCAAACACGCGAAACCCGTAGAAGACTCCAAAGCGATCGCACAAGTGGGCGCAATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: :::::::::::::: :: b33603 GCCGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :: ::::: :::::::: ::::: :::::: b33603 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCGATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: :: :::::: b33603 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b33603 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : ::::: ::::: ::: :::::::: :: ::::: :::: b33603 GATTTGGTTCCCATTCTCGAACAAGTTGCCCGTCAAGGCAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :: :: ::::: :::::::::::::::::::: : b33603 GAAGACATCGAAAAAGAAGCTTTGGCAACCCTAGTGGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: ::: ::::::: b33603 AACGTCACTGCGGTG 550


>>b33604 QQWB01000017 Microcystis  flos-aquae DF17        (555 nt)
 initn: 1717 init1: 1717 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::::::::: :: ::::::::::: ::::::::::: :: :: :::::: b33604 GCCACCGTTCTCGCTCACGCTATTGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :: ::::: ::::: :::: : : ::: : : :: b33604 AACCCGATTTCTCTGAAAAAAGGTATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: ::::: :::::::::::: : :::::::: :: :::::: b33604 GCCAAACACGCGAAACCCGTAGAAGATTCCAAAGCGATCGCACAAGTGGGCGCAATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: :::::::::::::: :: b33604 GCCGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :: ::::: :::::::: ::::: :::::: b33604 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCGATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: :: :::::: b33604 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b33604 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : ::::: ::::: ::: :::::::: :: ::::: :::: b33604 GATTTGGTTCCCATTCTCGAACAAGTTGCCCGTCAAGGCAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :: ::::::::::: : :: :: ::::: :::::::::::::::::::: : b33604 GAAGACATTGAAAAAGAAGCTTTGGCAACCCTAGTGGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: ::: ::::::: b33604 AACGTCACTGCGGTG 550


>>b31225 NZ_PEBC01000002 Cyanobacterium  aponinum  IPPAS  (555 nt)
 initn: 1666 init1: 1666 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :::::: : ::::: :: :: ::::::::::: ::::: :::::::: ::::::::: b31225 GCAACCGTATTAGCTCATGCTATTGTTAAAGAAGGTTTACGTAACGTTGCGGCTGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :::::::: :: : :: ::::: ::::::::::: :: :: ::::::: : :: ::: b31225 AACCCCATCGCTTTAAAACGTGGTATCGACAAAGCTACTGAACATTTAGTGGCTAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::: :: ::::: :::::: :: : ::::: ::::: :::::: b31225 GCTGAACACGCCCGTAAAGTAGAAGATAGCAAAGCTATTGCCCAAGTAGGTGCAATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::: :::::::: ::::: :::::::: ::::: ::::: :: : b31225 GCTGGTAACGATACCGAAGTCGGTGAAATGATTGCTCAAGCAATGGACAAAGTTGGACAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :::::::::::::::::::: ::::::::: :: ::::: ::::: :::::: b31225 GAAGGAGTTATCTCCCTCGAAGAAGGTAAGTCCATGGAAACTGAACTTGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :: ::::: ::::: :: ::::: :::::::: :::::::: :: ::::: ::::::::: b31225 GGTATGCGTTTTGACAAAGGTTACATCTCTCCTTACTTCGTAACCGATACCGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA ::::: ::::: ::::: :: :::: : : ::::: :: :::::: : :::: ::: b31225 GAGTGTGTTTTAGATGATCCTTACATCTTAGTAACCGACAAAAAAATCACCTTAGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: ::::: :: :: :::::::: ::::::::: :::::::: ::: : ::: : ::: b31225 GACTTAGTACCCGTTTTAGAACAAGTTGCTCGTCAAGGCAAACCTTTAATGATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::::::::: :: :::: ::::::::::: :: ::::: ::: b31225 GAAGACATCGAAAAAGAAGCGCTTGCAACCTTAGTTGTTAACCGTCTTCGTGGTGTCTTA 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :: :: :: b31225 AACGTAGCGGCAGTA 550


>>b32050 PVWM01000747 Chroococcidiopsis cubana CCALA 043  (555 nt)
 initn: 1738 init1: 1738 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :::::: : :::::::: :: :: :::::::: :: :: ::::::::::: ::::: b32050 GCAACCGTATTAGCTCACGCCATTGTAAAAGAAGGCTTGCGTAACGTTGCTGCGGGTGCA 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: : ::::: ::::::: :::::::: :::::: : : : :::: : :::::: b32050 AATGCAATTTCCCTCAAGCGCGGGATCGATAAAGCGGCTAACTTCCTAGTAGAAAAGATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::::: :: :: :: :: :: ::::::::: ::::::: ::: : :: ::: b32050 GCCGAACACGCTCGTCCTGTAGAGGATTCTAAAGCGATCGCTCAAGTCGGTTCGATTTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::::::::: ::::::::::::::: ::::::::::::: :: ::::: b32050 GCTGGTAACGATGAAGAAGTTGGCAGCATGATCGCTGAAGCGATGGATAAGGTGGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: :::::::::::::::::::: :::::::: ::::: :::::: b32050 GAAGGTGTCATTTCCCTAGAAGAAGGGAAGTCCATGACAACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: :: ::::: :::::::::::::::: :: ::: : :: :: ::: b32050 GGGATGCGCTTTGACAAAGGTTACATCTCTCCCTACTTCGCTACCGATCCCGAACGGATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: ::: : :: :: :: ::: :: : ::::: :::::::: :: : :::::: b32050 GAAGCTGTTCTAGACGAACCTTTCATTTTGATTACCGACAAGAAAATTGCTTTGGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: :: ::: :::: :: ::::: ::: :::: ::: : : ::: : :: b32050 GATTTAGTCCCCGTACTAGAGCAAGTTGCACGTTCTGGTCGTCCGCTGCTGATTTTGGCA 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::: :::::::::::::: :: :: ::::: :::::::::::::: :: ::: : b32050 GAAGATATTGAAAAAGAAGCGCTAGCAACCCTAGTTGTTAACCGTCTGCGTGGCGTACTC 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :::::::: b32050 AACGTAGCTGCGGTC 550


>>b32054 PVWL01000071 Cyanosarcina  cf. burmensis CCALA   (555 nt)
 initn: 1738 init1: 1738 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :::::: : :::::::: :: :: :::::::: :: :: ::::::::::: ::::: b32054 GCAACCGTATTAGCTCACGCCATTGTAAAAGAAGGCTTGCGTAACGTTGCTGCGGGTGCA 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: : ::::: ::::::: :::::::: :::::: : : : :::: : :::::: b32054 AATGCAATTTCCCTCAAGCGCGGGATCGATAAAGCGGCTAACTTCCTAGTAGAAAAGATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::::: :: :: :: :: :: ::::::::: ::::::: ::: : :: ::: b32054 GCCGAACACGCTCGTCCTGTAGAGGATTCTAAAGCGATCGCTCAAGTCGGTTCGATTTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::::::::: ::::::::::::::: ::::::::::::: :: ::::: b32054 GCTGGTAACGATGAAGAAGTTGGCAGCATGATCGCTGAAGCGATGGATAAGGTGGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: :::::::::::::::::::: :::::::: ::::: :::::: b32054 GAAGGTGTCATTTCCCTAGAAGAAGGGAAGTCCATGACAACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: :: ::::: :::::::::::::::: :: ::: : :: :: ::: b32054 GGGATGCGCTTTGACAAAGGTTACATCTCTCCCTACTTCGCTACCGATCCCGAACGGATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: ::: : :: :: :: ::: :: : ::::: :::::::: :: : :::::: b32054 GAAGCTGTTCTAGACGAACCTTTCATTTTGATTACCGACAAGAAAATTGCTTTGGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: :: ::: :::: :: ::::: ::: :::: ::: : : ::: : :: b32054 GATTTAGTCCCCGTACTAGAGCAAGTTGCACGTTCTGGTCGTCCGCTGCTGATTTTGGCA 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::: :::::::::::::: :: :: ::::: :::::::::::::: :: ::: : b32054 GAAGATATTGAAAAAGAAGCGCTAGCAACCCTAGTTGTTAACCGTCTGCGTGGCGTACTC 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :::::::: b32054 AACGTAGCTGCGGTC 550


>>b22606 ANKQ01000002 Microcystis aeruginosa TAIHU98      (555 nt)
 initn: 1669 init1: 1669 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: ::::: ::::: :: ::::::::::: ::::::::::: :: :: :::::: b22606 GCCACCGTTCTCGCCCACGCTATCGTTAAAGAAGGTTTACGCAACGTCGCCGCCGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::: :::::: : :: :: ::::: ::::: :::: : : ::: : : :: b22606 AACCCGATTTCTCTGAAAAAAGGTATCGATAAAGCTGCCGATTTCCTCGTCAGTCAAATC 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::: ::::: :: :::::::::::::::::: : :::::::: :: :::::: b22606 GCCAAACACGCGAAACCCGTAGAAGACTCCAAAGCGATCGCACAAGTGGGCGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::: :::::::: :: ::::::::::::::::: b22606 GCTGGTAACGATGATGAAGTCGGTCAAATGATCGCCTCGGCCATGGATAAAGTCGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: ::::::::::: :: ::::: :::::::: ::::: :::::: b22606 GAAGGCGTAATTTCCCTAGAAGAAGGGAAATCGATGACCACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: :: :::::::::::::::::::: :: :: :: :: :: :::::: b22606 GGGATGCGTTTTGACAAAGGTTATATCTCTCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::::: :: :: ::::: :: ::: : ::::: :: ::::::: ::::::: b22606 GAATGCGTTTTTGAGGATCCCGCTATTCTGATTACCGACAAAAAAATCGGTTTAGTACAG 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT ::::: :: :: : : ::::: :: :: ::: :: ::::: :: ::::: :::: b22606 GATTTGGTTCCCATTCTCGAACAAGTGGCCCGTCAAGGTAAACCCCTAGTAATTATCGCC 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: : :: :: ::::: :::::::::::::::::::: : b22606 GAAGACATCGAAAAAGAAGCTTTGGCAACCCTAGTGGTTAACCGTCTGCGCGGTGTTCTT 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: ::: ::::::: b22606 AACGTCACTGCGGTG 550


>>b31254 PEBC01000002 Cyanobacterium  aponinum  IPPAS B-  (555 nt)
 initn: 1666 init1: 1666 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :::::: : ::::: :: :: ::::::::::: ::::: :::::::: ::::::::: b31254 GCAACCGTATTAGCTCATGCTATTGTTAAAGAAGGTTTACGTAACGTTGCGGCTGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :::::::: :: : :: ::::: ::::::::::: :: :: ::::::: : :: ::: b31254 AACCCCATCGCTTTAAAACGTGGTATCGACAAAGCTACTGAACATTTAGTGGCTAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::: :: ::::: :::::: :: : ::::: ::::: :::::: b31254 GCTGAACACGCCCGTAAAGTAGAAGATAGCAAAGCTATTGCCCAAGTAGGTGCAATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::: :::::::: ::::: :::::::: ::::: ::::: :: : b31254 GCTGGTAACGATACCGAAGTCGGTGAAATGATTGCTCAAGCAATGGACAAAGTTGGACAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :::::::::::::::::::: ::::::::: :: ::::: ::::: :::::: b31254 GAAGGAGTTATCTCCCTCGAAGAAGGTAAGTCCATGGAAACTGAACTTGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :: ::::: ::::: :: ::::: :::::::: :::::::: :: ::::: ::::::::: b31254 GGTATGCGTTTTGACAAAGGTTACATCTCTCCTTACTTCGTAACCGATACCGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA ::::: ::::: ::::: :: :::: : : ::::: :: :::::: : :::: ::: b31254 GAGTGTGTTTTAGATGATCCTTACATCTTAGTAACCGACAAAAAAATCACCTTAGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: ::::: :: :: :::::::: ::::::::: :::::::: ::: : ::: : ::: b31254 GACTTAGTACCCGTTTTAGAACAAGTTGCTCGTCAAGGCAAACCTTTAATGATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::::::::: :: :::: ::::::::::: :: ::::: ::: b31254 GAAGACATCGAAAAAGAAGCGCTTGCAACCTTAGTTGTTAACCGTCTTCGTGGTGTCTTA 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :: :: :: b31254 AACGTAGCGGCAGTA 550


>>b29641 NZ_NEED01000002 Cyanobacterium sp. SU2           (555 nt)
 initn: 1678 init1: 1678 opt: 1744  Z-score: 79.9  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1744; 79.4% identity (79.4% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: ::::: :: :: ::::: :: ::::::::::: ::::::::::: ::::: :: ::: b29641 GCCACCGTTCTTGCCCACGCTATTGTTAAAGAAGGATTACGCAACGTAGCTGCCGGAGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::::::::: : ::::::: :: : :::::::: ::::::: :::::::: :: ::: b29641 AACCCCATTGCCCTCAAGCGAGGTGTAGACAAAGCAACCGAGTTCTTAGTCGGAAAAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::::::::: : :::::::::::::::::: : ::::::::::: :: ::: b29641 GCTGAACACGCTAAACCCATCGAAGACTCCAAAGCGATCGCCCAAGTGGGTGCTATATCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG ::::: :: ::::::::::: :: ::::::::: : :: ::::: ::::: :: :: b29641 GCGGGGAATGATGAAGAAGTGGGTCAGATGATCGCTAACGCCATGGACAAAGTGGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA :: :: :: :: ::::: :::::::: ::::::::::: :: ::: : :::::::::::: b29641 GAGGGAGTCATTTCCCTTGAAGAAGGAAAGTCCATGACCACAGAATTAGAAATTACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG ::::::::::: :: :: :: :: :: :: :::::::: :: :: :: :: :: :::::: b29641 GGGATGCGCTTCGACAAAGGCTACATTTCCCCCTACTTTGTCACCGACACCGAACGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :: :: ::::: :: ::: ::::::::::: :: ::::: : : :::::: b29641 GAAGCGGTATTTGATGATCCGAGCATTCTGCTCACCGACAAAAAAATTACCTTGGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: :::: :: :: ::::::::::::::::: :::::::: : : ::: : ::: b29641 GACCTAGTACCAGTCTTAGAACAGGTTGCTCGCCAAGGCAAACCTCTCGTTATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: :: :: :: ::::: ::::::::: :::: ::::: :: b29641 GAAGACATCGAAAAAGAAGCCCTAGCAACCCTAGTGGTTAACCGTTTGCGGGGTGTTCTA 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT : :: :::::::: b29641 ACGGTGGCTGCGGTG 550


>>b33173 QBMS01000016 Snowella  sp. ULC335bin1            (555 nt)
 initn: 1660 init1: 1660 opt: 1740  Z-score: 79.7  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1740; 79.3% identity (79.3% similar) in 555 nt overlap (1-555:1-555)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :: :: ::::: :: :: :: :: :::::::: ::::::::::: :: :: :::::: b33173 GCAACGGTTCTCGCCCATGCCATTGTCAAAGAAGGTTTACGCAACGTCGCCGCAGGTGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: :: :: : ::::: :: :: :::::::::::::: :: : :: :: : :::: b33173 AATCCTATCGCCATCAAACGCGGTATCGACAAAGCGACTGAATTCTTGGTTGAACGGATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::::::::: :::::::: ::::: :::::: : ::::: ::: : :::::: b33173 GCTGAACACGCTAAACCCGTTGAAGATTCCAAGGCGATCGCCCAAGTAGGTTCGATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG ::::::::::: :::::::: :: ::::: :: : ::::::::::::::::: :: b33173 GCGGGTAACGACGAAGAAGTGGGTCAAATGATTGCCAATGCGATGGATAAAGTCGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA :: :: :: :: ::::: :::::::: :: :::::::: :::::: : ::::: :::::: b33173 GAGGGCGTAATTTCCCTTGAAGAAGGCAAATCCATGACCACCGAATTGGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::: ::::: ::::::::::::::::::::::: :: :: ::: : ::::::::: b33173 GGGATGCGTTTTGACAAGGGTTATATCTCTCCCTACTTTGTCACCGATCCTGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::::: :: :: :: :: ::: :: ::::::: :: :::::: :::: ::: b33173 GAAGCCGTTTTAGAAGATCCTGCGATCTTGATCACCGACAAAAAAATCAACTTAGTCCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: ::::: : :: :: ::::: ::: ::::: :: : :: :: : ::: b33173 GATTTAGTTCCTGTTCTTGAGCAAGTTGCCCGTCAAGGCAAGCCCCTCTTGATCATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA ::::: :::::::::::::: ::::: :: :::: :: ::::::::::::::::: :: b33173 GAAGACATCGAAAAAGAAGCCCTTGCAACCTTAGTGGTGAACCGTCTGCGCGGTGTCTTG 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :::::::: :: ::: b33173 AATGTCGCAGCCGTT 550


>>b13340 AB039628 Pleurocapsa sp. PCC 7327                (555 nt)
 initn: 1684 init1: 1684 opt: 1740  Z-score: 79.7  bits: 24.6 E(): 2.2e+02
banded Smith-Waterman score: 1740; 79.3% identity (79.3% similar) in 555 nt overlap (1-555:1-555)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :::::::::::::::::::: :::::::::::::: :: ::::::::::::::::: ::: b13340 GCTACCGTACTCGCTCACGCCATGGTTAAAGAAGGCTTGCGCAACGTTGCTGCTGGCGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :::::::: :::::::::: ::::: :: ::::: :: :: : : : :: : : ::: b13340 AACCCCATCGCTATCAAGCGCGGGATTGAAAAAGCAACGGAATTTCTTGTAGAAAGAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: :::::::::: : : :: ::::: :: ::::::::: ::::::: ::: : :::::: b13340 GCCGAACACGCTATATCAGTAGAAGATTCTAAAGCGATCGCTCAAGTTGGTTCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: :::::::: ::::::::::: ::::: :: :: ::::: ::::: :: :: b13340 GCTGGTAACGACGAAGAAGTCGGTCAGATGATTGCCAGTGCCATGGACAAAGTGGGCAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :::::::: ::::: ::::: ::::: ::::: :::::::: ::::: ::::: b13340 GAAGGTGTTATCTCTCTCGAGGAAGGTAAGTCTATGACTACCGAACTGGAAATCACCGAG 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG ::::::::::: ::: :::: :::::::::::::::::::: :: ::: : ::::::::: b13340 GGGATGCGCTTCGATGAGGGCTATATCTCTCCCTACTTCGTCACCGATGCCGAGCGCATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :: : :: :: :: ::: : : ::::: :::::::: :: :: :: ::: b13340 GAAGCGGTAATGGACGAGCCTCTGATCTTAATTACCGACAAGAAAATTGCCCTCGTTCAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :: : :: :: ::: : ::::: ::::: ::: :::::::: ::: : ::: : ::: b13340 GACCTCGTTCCCGTACTCGAACAAGTTGCCCGTCAAGGCAAACCTTTACTGATTATTGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :: ::::::::::::::::: :: ::::: :: ::::: ::::: :::::::: :: : b13340 GAGGATATCGAAAAAGAAGCCCTCGCTACCCTGGTCGTCAACCGCCTGCGCGGAGTCCTG 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT ::::: ::::: ::: b13340 AATGTTGCTGCTGTT 550


>>b13342 AB039626 Chroococcidiopsis thermalis PCC 7203    (555 nt)
 initn: 1729 init1: 1729 opt: 1735  Z-score: 79.6  bits: 24.5 E(): 2.3e+02
banded Smith-Waterman score: 1735; 79.2% identity (79.2% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :: :::::: : :::::::: :: :: :::::::: :: :: ::::::::::: ::::: b13342 GCAACCGTATTAGCTCACGCCATTGTAAAAGAAGGCTTGCGTAACGTTGCTGCGGGTGCA 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT :: : ::::: ::::::: :::::::: :::: : : : : :::: : :::::: b13342 AATGCAATTTCCCTCAAGCGCGGGATCGATAAAGTGGCTAACTTCCTAGTAGAAAAGATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::::: :: :: :: :: :: ::::::::: ::::::: ::: : :: ::: b13342 GCCGAACACGCTCGTCCTGTAGAGGATTCTAAAGCGATCGCTCAAGTCGGTTCGATTTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::::::::: ::::::::::::::: ::::::::::::: :: ::::: b13342 GCTGGTAACGATGAAGAAGTTGGCAGCATGATCGCTGAAGCGATGGATAAGGTGGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::::: :::::::::::::::::::: :::::::: ::::: :::::: b13342 GAAGGTGTCATTTCCCTAGAAGAAGGGAAGTCCATGACAACCGAACTAGAAATCACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :::::::::::::: :: ::::: :::::::::::::::: :: ::: : :: :: ::: b13342 GGGATGCGCTTTGACAAAGGTTACATCTCTCCCTACTTCGCTACCGATCCCGAACGGATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: ::: : :: :: :: ::: :: : ::::: :::::::: :: : :::::: b13342 GAAGCTGTTCTAGACGAACCTTTCATTTTGATTACCGACAAGAAAATTGCTTTGGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: :: ::: :::: :: ::::: ::: :::: ::: : : ::: : :: b13342 GATTTAGTCCCCGTACTAGAGCAAGTTGCACGTTCTGGTCGTCCGCTGCTGATTTTGGCA 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::: :::::::::::::: :: :: ::::: :::::::::::::: :: ::: : b13342 GAAGATATTGAAAAAGAAGCGCTAGCAACCCTAGTTGTTAACCGTCTGCGTGGCGTACTC 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: :::::::: b13342 AACGTAGCTGCGGTC 550


>>b34822 BJCE01000279 Sphaerospermopsis  reniformis  NIE  (555 nt)
 initn: 1671 init1: 1671 opt: 1735  Z-score: 79.6  bits: 24.5 E(): 2.3e+02
banded Smith-Waterman score: 1735; 79.2% identity (79.2% similar) in 554 nt overlap (1-554:1-554)

10 20 30 40 50 60 b12498 GCTACCGTACTCGCTCACGCAATGGTTAAAGAAGGGTTACGCAACGTTGCTGCTGGTGCT :::::::: : ::::: ::::: ::::::::::: ::::: ::::: :::::::: ::: b34822 GCTACCGTTTTGGCTCATGCAATTGTTAAAGAAGGTTTACGGAACGTAGCTGCTGGCGCT 10 20 30 40 50 60 70 80 90 100 110 120 b12498 AACCCCATTTCTATCAAGCGTGGGATCGACAAAGCGACCGAGTATTTAGTCGGCAAGATT ::: : ::: : ::::: :: :: :: ::::: :: : :: :::::: : : ::: b34822 AACGCAATTCTGTTGAAGCGCGGTATTGATAAAGCTACTGCGTTTTTAGTAGAAAGAATT 70 80 90 100 110 120 130 140 150 160 170 180 b12498 GCAGAACACGCTAAACCGGTTGAAGACTCCAAAGCGATCTCTCAAGTGGGTGCCATCTCT :: ::::::::: :: :: ::::: :: :: :::::: ::::::: ::::: :::::: b34822 GCTGAACACGCTCGTCCTGTAGAAGATTCTAAGGCGATCGCTCAAGTTGGTGCTATCTCT 130 140 150 160 170 180 190 200 210 220 230 240 b12498 GCGGGTAACGATGAAGAAGTCGGCAGCATGATCGCTCAAGCGATGGATAAAGTCGGTAAG :: ::::::::::: :::::::::::::::::::: ::::: :::::::: :: ::::: b34822 GCTGGTAACGATGATGAAGTCGGCAGCATGATCGCCCAAGCTATGGATAAGGTGGGTAAA 190 200 210 220 230 240 250 260 270 280 290 300 b12498 GAAGGGGTTATCTCCCTCGAAGAAGGGAAGTCCATGACGACCGAACTCGAAATTACCGAA ::::: :: :: ::: : :::::::: ::::::::::: :::::: : :::::::::::: b34822 GAAGGTGTAATTTCCTTGGAAGAAGGAAAGTCCATGACCACCGAATTGGAAATTACCGAA 250 260 270 280 290 300 310 320 330 340 350 360 b12498 GGGATGCGCTTTGATAAGGGTTATATCTCTCCCTACTTCGTGACTGATACAGAGCGCATG :: ::::: ::::::::::::::::: :: :: ::::::: :: ::: :::: :: ::: b34822 GGTATGCGTTTTGATAAGGGTTATATTTCCCCTTACTTCGCTACCGATGCAGAACGGATG 310 320 330 340 350 360 370 380 390 400 410 420 b12498 GAGTGCGTTTTCGATGACCCCGCCATCCTGCTCACCGATAAGAAAATCGCGCTAGTACAA :: :::: ::::: :: :::::::::::::::::::::::: :: : :::::: b34822 GAAGCGATTTTTGATGATCCTTACATCCTGCTCACCGATAAGAAAATTGCTTTGGTACAA 370 380 390 400 410 420 430 440 450 460 470 480 b12498 GATTTAGTGCCTGTATTAGAACAGGTTGCTCGTGCTGGCAAACCGTTATTAATTCTCGCT :::::::: :::::: : :: :: ::::: ::: :: :: :: : : ::: ::::: b34822 GATTTAGTACCTGTACTTGAGCAAGTTGCACGTCAAGGTAAGCCCCTGGTTATTATCGCT 430 440 450 460 470 480 490 500 510 520 530 540 b12498 GAAGATATCGAAAAAGAAGCGCTTGCTACTCTAGTCGTTAACCGTCTGCGCGGTGTATTA :::::::: ::::::::::: : :::::: : :: ::::::::: : :: ::::: : b34822 GAAGATATTGAAAAAGAAGCTTTAGCTACTTTGGTTGTTAACCGTTTACGTGGTGTGCTG 490 500 510 520 530 540 550 b12498 AATGTCGCTGCGGTT :: :: ::::: :: b34822 AACGTAGCTGCTGTA 550




555 residues in 1 query   sequences
10049508 residues in 18128 library sequences
 Scomplib [35.03]
 start: Mon Sep 21 01:48:42 2020 done: Mon Sep 21 01:48:43 2020
 Total Scan time:  1.690 Total Display time:  0.010

Function used was FASTA [version 35.03 Feb. 18, 2008]